View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17188_low_28 (Length: 318)
Name: NF17188_low_28
Description: NF17188
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17188_low_28 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 285; Significance: 1e-160; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 1 - 301
Target Start/End: Original strand, 12131997 - 12132297
Alignment:
| Q |
1 |
aaattagggtttctccgattccccaaattttcaaattagggtttctactcgccatggcagatggctactggaaccgccagcagtctcttctcccccattc |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12131997 |
aaattagggtttctccgatttcccaaattttcaaattagggtttctactcgccatggcagatggctactggaaccgccagcagtctcttctcccccattc |
12132096 |
T |
 |
| Q |
101 |
cggcctgcacaaacgtccccgtcctgactacggttcgtttcccccttttcttcccaatcaatcaatttcatgcttaattgttgtttgtttcgtgcaattt |
200 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12132097 |
cggcctgcacaaacgtccccgccctgactacggttcgtttcccccttttcttcccaatcaatcaatttcatgcttaattgttgtttgtttcgtgcaattt |
12132196 |
T |
 |
| Q |
201 |
attatctttctctttcatcttgattattgttgctatttttgatgcaaattcatggaggtgtgtgaataattcgatgcttcaagagtcttgctttctgttt |
300 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
12132197 |
attatctttctctttcatcatgattattgttgctatttttgatgcaaattcatggaggtgtgtgaataattcgatgcttcaagagtcttgctttttgttt |
12132296 |
T |
 |
| Q |
301 |
g |
301 |
Q |
| |
|
| |
|
|
| T |
12132297 |
g |
12132297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University