View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17189_high_4 (Length: 431)
Name: NF17189_high_4
Description: NF17189
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17189_high_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 157; Significance: 2e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 11 - 224
Target Start/End: Complemental strand, 43976274 - 43976049
Alignment:
| Q |
11 |
caaaggggctaaaaaggatgtgggggagatttttgatgcggttaagaccttatcttggtgttggtgtcttaatagtagattggaaattggtgcttttatg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
43976274 |
caaaggggctaaaaaggatgtgggggagatttttgatgcggttaagaccttatcttggtgttggtgtcgtaa---tagattggaaattggtgcttttatg |
43976178 |
T |
 |
| Q |
111 |
ttcttcgaatggtgttggaat---------------tctaggtaggtgttttttggtgcagctgcccggattgtggtgcggtgtacaaatagcccaactg |
195 |
Q |
| |
|
|||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43976177 |
ttcttcaaatggtgttggaattctagggattgtttatctaggtaggtgttttttggtgcagctgcccggattgtggtgcggtgtacaaatagcccaactg |
43976078 |
T |
 |
| Q |
196 |
cacggcagtttgttttagcctacagttgg |
224 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
43976077 |
cacggcagtttgttttagcctacagttgg |
43976049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 48; Significance: 3e-18; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 24 - 137
Target Start/End: Complemental strand, 18021645 - 18021535
Alignment:
| Q |
24 |
aaggatgtgggggagatttttgatgcggttaagaccttatcttggtgttggtgtcttaatagtagattggaaattggtgcttttatgttcttcgaatggt |
123 |
Q |
| |
|
||||| ||||| ||||||||||| ||| | ||||| |||||||||||||||||||| || ||||||| |||| ||||| ||| ||||||| ||||||| |
|
|
| T |
18021645 |
aaggaggtgggtgagatttttgacgcgataaagactttatcttggtgttggtgtctcaa---tagattgaaaataggtgcatttgtgttctttgaatggt |
18021549 |
T |
 |
| Q |
124 |
gttggaattctagg |
137 |
Q |
| |
|
|||||||| ||||| |
|
|
| T |
18021548 |
gttggaatcctagg |
18021535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 371 - 407
Target Start/End: Original strand, 5961957 - 5961993
Alignment:
| Q |
371 |
ttcgccccttcctcttttcttatgaggttgggtgcct |
407 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
5961957 |
ttcgccccttcctctcttcttatgaggttgggagcct |
5961993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000006; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 371 - 407
Target Start/End: Complemental strand, 31646917 - 31646881
Alignment:
| Q |
371 |
ttcgccccttcctcttttcttatgaggttgggtgcct |
407 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
31646917 |
ttcgccccttcctctcttcttatgaggttgggagcct |
31646881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 209 - 245
Target Start/End: Complemental strand, 31647083 - 31647047
Alignment:
| Q |
209 |
tttagcctacagttggtttaatttgttgctggttttt |
245 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
31647083 |
tttagccttcagttggtttagtttgttgctggttttt |
31647047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University