View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17189_low_11 (Length: 328)
Name: NF17189_low_11
Description: NF17189
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17189_low_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 18 - 286
Target Start/End: Original strand, 11613381 - 11613649
Alignment:
| Q |
18 |
gttcctttgtcattgattttacatgtcacagatataggtggttaagtttggattgctgaatattaaagggaagtttaattttggttgtcaaagattgtga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
11613381 |
gttcctttgtcattgattttacatgtcacagagataggtggttaagtttggattgctgaatattaaagggaagttcaattttggttgtcaaagattgtga |
11613480 |
T |
 |
| Q |
118 |
agggacttgaatttaaatgcatggatcgaggggaccaaatggcggcattatccggttctgcatcatactttatgcagagaggattacctggttctggaaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11613481 |
agggacttgaatttaaatgcatggatcgaggggaccaaatggcggcattatccggttctgcatcatactttatgcagagaggattacctggttctggaaa |
11613580 |
T |
 |
| Q |
218 |
ccaacatgagttgcataattcgcctggtattcgtccaccgaataccaattcatcgtttcaatcaagcat |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
11613581 |
ccaacatgagttgcataattcgcctggtattcgtccactgaataccaattcatcgtttcaatcaagcat |
11613649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University