View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17189_low_18 (Length: 207)

Name: NF17189_low_18
Description: NF17189
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17189_low_18
NF17189_low_18
[»] chr1 (1 HSPs)
chr1 (9-187)||(47988543-47988722)


Alignment Details
Target: chr1 (Bit Score: 114; Significance: 5e-58; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 114; E-Value: 5e-58
Query Start/End: Original strand, 9 - 187
Target Start/End: Original strand, 47988543 - 47988722
Alignment:
9 agcaaaggtagaaattaaaaatggcattacagcatgtggtagaaacatggtggatataaataaccnnnnnnnnnnnnn---gtgcagaaaagtatcaaca 105  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||                |||||||||||||||||||    
47988543 agcaagggtagaaattaaaaatggcattacagcatgtggtagaaacatggtggatataaataaccaaaaaaaaaaaaaaaagtgcagaaaagtatcaaca 47988642  T
106 tatgagaagagcattgtatggataatgataaattactaaccagtgtggtctccaaaattaaacttgtatgctcttgatgcag 187  Q
    ||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||    
47988643 tatgagaagagcattgtatggataatgataaattactaacca--gtggtctccaaaattaaacttgtatgctcttgatgcag 47988722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University