View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17189_low_3 (Length: 468)
Name: NF17189_low_3
Description: NF17189
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17189_low_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 95; Significance: 3e-46; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 308 - 426
Target Start/End: Original strand, 11576006 - 11576123
Alignment:
| Q |
308 |
attttagcatatattgttattcgttatctaatagttcagctaatgtgagttgtaaacatgttcgctatccattaatttatcattgtacgctacaatggat |
407 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11576006 |
atttcagcatat-ttgttattcgttatctaatagttcaactaatgtgagttgtaaacatattcgctatccattaatttatcattgtacgctacaatggat |
11576104 |
T |
 |
| Q |
408 |
caaacattacctaaatatg |
426 |
Q |
| |
|
|||||||| |||||||||| |
|
|
| T |
11576105 |
caaacattgcctaaatatg |
11576123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University