View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17189_low_6 (Length: 344)
Name: NF17189_low_6
Description: NF17189
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17189_low_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 299; Significance: 1e-168; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 299; E-Value: 1e-168
Query Start/End: Original strand, 11 - 325
Target Start/End: Complemental strand, 1450163 - 1449849
Alignment:
| Q |
11 |
cacagaaaagctaaggcaattggcttaaaactacaacggagcagtttgtacataaaactatttcttggattgtctttatatcttgaatttatcaaaacat |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
1450163 |
cacagaaaagctaaggcaattggcttaaaactacaatggagcagtttgtacataaaactattgcttggattgtctttatatcttgaatttatgaaaacat |
1450064 |
T |
|
| Q |
111 |
aaattattgctgaaacctaaatatacaaatgaacaaataaggaagatatatcagcaataaaagaatgataaagcttctatatatcttctaagacatttag |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1450063 |
aaattattgctgaaacctaaatatacaaatgaacaaataaggaagatatatcagcaataaaagaatgataaagcttctatatatcttctaagacatttag |
1449964 |
T |
|
| Q |
211 |
gtggagctttctagctttgctctcaggtccttcctcaatatctttcctgcaggagactttggaattgcatgaacaaaatatactttgtgcagtcttttat |
310 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1449963 |
gtggagctttctagctttgctttcaggtccttcctcaatatctttcctgcaggagactttggaattgcatgaacaaaatatactttgtgcagtcttttat |
1449864 |
T |
|
| Q |
311 |
aaaataccacctgtt |
325 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
1449863 |
aaaataccacctgtt |
1449849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University