View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17189_low_9 (Length: 334)
Name: NF17189_low_9
Description: NF17189
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17189_low_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 141; Significance: 7e-74; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 141; E-Value: 7e-74
Query Start/End: Original strand, 106 - 266
Target Start/End: Complemental strand, 11574571 - 11574412
Alignment:
| Q |
106 |
tatccatattatcatcatcatcatataataataagagaacaccaaccaaatgagactgtagcctgtaccttcatggctgatgcacatggtatgcgtcatt |
205 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
11574571 |
tatcaatattatcatcatcatcatataataataagagaacaccaaccaaatgagactgtagcctgtaccttcatggctgatgcacatggtatgtgtcatt |
11574472 |
T |
|
| Q |
206 |
tacctagttggatgtgcaataatgccattttgtattctgatagatgcacgatttgcatctt |
266 |
Q |
| |
|
||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11574471 |
tacct-gttgcatgtgcaataatgccattttgtattctgatagatgcacgatttgcatctt |
11574412 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 57 - 114
Target Start/End: Complemental strand, 11574789 - 11574732
Alignment:
| Q |
57 |
gatataatttgcatttaacaaatgacatgcatttttcactagattgccttatccatat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11574789 |
gatataatttgcatttaacaaatgacatgcatttttcactagattgccttatccatat |
11574732 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 1 - 53
Target Start/End: Complemental strand, 11574930 - 11574878
Alignment:
| Q |
1 |
ctgaaattaaacaaagggaaagtgtaatttagccaaatatttatgcagccttt |
53 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
11574930 |
ctgaaattaaacaaagagaaagtgtaatttagccaaatatttatgcagccttt |
11574878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 265 - 319
Target Start/End: Complemental strand, 11574377 - 11574323
Alignment:
| Q |
265 |
ttcatacactaataaatcacaatcagagatagatgagactttagaaaaagttaga |
319 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| || |||||||||||| ||||| |
|
|
| T |
11574377 |
ttcatacactaataaatcacaatcgaagatagacgaaactttagaaaaaattaga |
11574323 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University