View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1718_high_12 (Length: 261)
Name: NF1718_high_12
Description: NF1718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1718_high_12 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 1 - 261
Target Start/End: Complemental strand, 5399840 - 5399580
Alignment:
| Q |
1 |
ttttcaggaacgtttcatatcacgaagctcatatctaaaacgccacctaacatccctctccgacttcacactctccccaccattaaacataacggcttca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5399840 |
ttttcaggaacgtttcatatcacgaagctcatatctaaaacgccacctaacatccctctccgacttcacactctccccaccattaaacataacggcttca |
5399741 |
T |
 |
| Q |
101 |
acattcacaaccgttgcagaattttgttacaaccgtaaaatccatttaacaccaacaaacattgcagccgttataacggcagcagagttactaggaatga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
5399740 |
tcattcacaaccgttgcagaattttgttacaaccgtaaaatccatttaacaccaacaaacattgcagccgttataacgacagcagagttactaggaatga |
5399641 |
T |
 |
| Q |
201 |
aagaaggtgacattaatctacgtgacgtggcagaatcttattttcaaagaattgtttgcat |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5399640 |
aagaaggtgacattaatctacgtgacgtggcagaatcttattttcaaagaattgtttgcat |
5399580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University