View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1718_high_18 (Length: 247)
Name: NF1718_high_18
Description: NF1718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1718_high_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 49734167 - 49734395
Alignment:
| Q |
1 |
cgttgcttctgtcctccagaaagttgtatccctctctcccctactattgtgtcatacccctgcatatgttgtttttcaacaattcagaatctcataagcc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
49734167 |
cgttgcttctgtcctccagaaagttgtatccctctctcccctactattgtgtcatacccctgcatatgttgtttttcaacaattcagaacctcataagcc |
49734266 |
T |
 |
| Q |
101 |
atgctacacaaatagctagttatttgaaatattggaattcacatgtttgttgcaaactatgaaacagtcacacagacattgaatatgacttcagatcgat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
49734267 |
atgctacacaaatagctagttatttgaaatattggaattcacatgtttgttgcaaactatgaaatagtcacacagacattgaatatgacttcagatcgat |
49734366 |
T |
 |
| Q |
201 |
gacgtgtttagtgacatgtgtagtgtctg |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
49734367 |
gacgtgtttagtgacatgtgtagtgtctg |
49734395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 79; Significance: 5e-37; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 1 - 143
Target Start/End: Complemental strand, 51216335 - 51216193
Alignment:
| Q |
1 |
cgttgcttctgtcctccagaaagttgtatccctctctcccctactattgtgtcatacccctgcatatgttgtttttcaacaattcagaatctcataagcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| ||| ||||||||||| ||||||||||||||||||| |||||| | ||||||||| ||| |||| | |
|
|
| T |
51216335 |
cgttgcttctgtcctccagaaagttgaatccctcgctctcctactattgtatcatacccctgcatatgttatttttctagaattcagaacctcgtaaggc |
51216236 |
T |
 |
| Q |
101 |
atgctacacaaatagctagttatttgaaatattggaattcaca |
143 |
Q |
| |
|
|||| || | |||||||||||||||||||||| |||||||| |
|
|
| T |
51216235 |
atgcatcataggtagctagttatttgaaatattgcaattcaca |
51216193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University