View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1718_high_21 (Length: 241)
Name: NF1718_high_21
Description: NF1718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1718_high_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 2 - 226
Target Start/End: Original strand, 8498745 - 8498969
Alignment:
| Q |
2 |
tgaagattttatgggatctgaagaactctaatgaagattcggctttgttgttgagaagtaaagtcttcagaggtaagagggttatcactcatcacatttt |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
8498745 |
tgaagattttatgggatctgaagaactctaatgaagattcggctttgttgttgagaagtcaagtcttcagaggtaagagagttatcactcatcacatttt |
8498844 |
T |
 |
| Q |
102 |
ttcttctctttggagtagcataaaatccgaagtttctactttagagaataattgcagatggatcatatgaaatggtgaaaatatcaatttttggcttgac |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
8498845 |
ttcttctctttggagtagcataaaatccgaagtttctactttagagaataattgcagatggatcataggaaatggtaaaaatatcaatttttggcttgac |
8498944 |
T |
 |
| Q |
202 |
tcctggtgtgacagacctattgttt |
226 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
8498945 |
tcctggtgtgacagacctattgttt |
8498969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 154 - 200
Target Start/End: Original strand, 27447926 - 27447972
Alignment:
| Q |
154 |
tgcagatggatcatatgaaatggtgaaaatatcaatttttggcttga |
200 |
Q |
| |
|
||||| ||||||||| | ||||| ||||||||||||||||||||||| |
|
|
| T |
27447926 |
tgcagctggatcataggtaatggggaaaatatcaatttttggcttga |
27447972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 154 - 200
Target Start/End: Original strand, 27460277 - 27460323
Alignment:
| Q |
154 |
tgcagatggatcatatgaaatggtgaaaatatcaatttttggcttga |
200 |
Q |
| |
|
||||| ||||||||| | ||||| ||||||||||||||||||||||| |
|
|
| T |
27460277 |
tgcagctggatcataggtaatggggaaaatatcaatttttggcttga |
27460323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 151 - 223
Target Start/End: Original strand, 48709423 - 48709495
Alignment:
| Q |
151 |
aattgcagatggatcatatgaaatggtgaaaatatcaatttttggcttgactcctggtgtgacagacctattg |
223 |
Q |
| |
|
|||||||| ||||||||| | ||||| || ||||| |||||||||||||| ||||| ||||| |||||||| |
|
|
| T |
48709423 |
aattgcagctggatcataggtaatggagagaatattaatttttggcttgatacctggattgacaaacctattg |
48709495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University