View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1718_high_9 (Length: 356)
Name: NF1718_high_9
Description: NF1718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1718_high_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 24 - 349
Target Start/End: Complemental strand, 2741650 - 2741324
Alignment:
| Q |
24 |
agtatggcggaatttttgtaaagcatactggtattttataacaaacatcatagttcattggtaaagtttgaaatttttggaccaaatcatctctcacttt |
123 |
Q |
| |
|
|||| |||| ||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||| | || ||||| ||||||||||| |
|
|
| T |
2741650 |
agtacggcgaaatttttgtaaagtatactggtattttataacaaaaatcatagttcattggtaaagtttgaaattctgttactaaatcgtctctcacttt |
2741551 |
T |
|
| Q |
124 |
tatatatcaaaatgatcactattgatcagctatccaaactccattaacccaaatttcacccaaacctctggaatgaacatccgacttcagggacagacag |
223 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||| ||| |||| |
|
|
| T |
2741550 |
tatataacaaaatgatcactattgatcagctatccaaactccattaacccaaatttcactcaaacctctggaatgaacatgtaacttcaggtacaaacag |
2741451 |
T |
|
| Q |
224 |
actctgtttcagctcatg-tctccgttatttttcaaatgcttattttcttcaatggaatcttagatatgagattcaaacatttgttttacacgcaagctt |
322 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||||| |||||||||| ||| ||| |||||||||||||||||||||||||||||||||| | ||||||| |
|
|
| T |
2741450 |
actctgtttcagctcatgatctccgctatttttcaactgcttattttattcgatgaaatcttagatatgagattcaaacatttgttttacccacaagctt |
2741351 |
T |
|
| Q |
323 |
aaagaaaatcatatactaattcatctc |
349 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
2741350 |
aaagaaaatcatatactaattcatctc |
2741324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University