View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1718_low_16 (Length: 249)
Name: NF1718_low_16
Description: NF1718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1718_low_16 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 114; Significance: 6e-58; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 124 - 249
Target Start/End: Complemental strand, 21484600 - 21484475
Alignment:
| Q |
124 |
acaccattgaaaaccattgcatgtacttcaactacaacaactactacctcttcttcttcctcagcttcttcttcatctgcagcttcttgggatgttttga |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
21484600 |
acaccattgaaaaccattgcatgtacttcaactacaacaactactacctcttcttcttcctcagcttcttcttcatctgcagcttcttgggctgttttga |
21484501 |
T |
 |
| Q |
224 |
aatcagatgttgaagtaagtcatcaa |
249 |
Q |
| |
|
||||||||||||||||| ||||||| |
|
|
| T |
21484500 |
aatcagatgttgaagtagatcatcaa |
21484475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 1 - 93
Target Start/End: Complemental strand, 21484723 - 21484631
Alignment:
| Q |
1 |
gatcaagatggtgatcttttaggtatgaatatgaatgatgatgcatctatgttctatgctgattttccacctttacctgattttccatgcatg |
93 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
21484723 |
gatcaagatggtgatcttttaggtatgaatatgaatgatgatgcatctatgttctatgctgattttcctcctttacctgattttccatgcatg |
21484631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University