View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1718_low_20 (Length: 242)
Name: NF1718_low_20
Description: NF1718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1718_low_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 14 - 231
Target Start/End: Original strand, 44232482 - 44232703
Alignment:
| Q |
14 |
ccattttcaaatgatattacaataacttgttaacacagtcaactatgtgcacttccatcttacacaacaaataatcagatgcactatctctagaacacat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44232482 |
ccattttcaaatgatattacaataacttgttaacacagtcaactatgtgcacttccatcttacacaacaaataatcagatgcactatctctagaacacat |
44232581 |
T |
 |
| Q |
114 |
ttgtcctgtccttacacgttcatccaaagtcttgagatgtctcaactctcgata----cgttcatctaagatcgaggataataggaaaggtggctatagg |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44232582 |
ttgtcctgtccttacacgttcatccaaagtcttgagatgtctcaactctagatacgttcgttcatctaagatcgaggataataggaaaggtggctatagg |
44232681 |
T |
 |
| Q |
210 |
tgactctctgatttgcgagtat |
231 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
44232682 |
tgactctctgatttgcgagtat |
44232703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 18 - 71
Target Start/End: Original strand, 44232432 - 44232485
Alignment:
| Q |
18 |
tttcaaatgatattacaataacttgttaacacagtcaactatgtgcacttccat |
71 |
Q |
| |
|
||||||||||||| |||||||||| |||||||||||| |||||| |||||||| |
|
|
| T |
44232432 |
tttcaaatgatatcgcaataacttgctaacacagtcaaatatgtgtacttccat |
44232485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University