View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1718_low_22 (Length: 237)
Name: NF1718_low_22
Description: NF1718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1718_low_22 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 7750144 - 7749927
Alignment:
| Q |
1 |
tacacaatcatggaaacatctatatataatgattttgttgatgcatttgcaaaagaatttgaagatgttccaaaagttaagccagtgaagccttttaagc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
7750144 |
tacacaatcatggaaacatctatatataatgattttgttgatgcatttgcaaaagaacttgaagatgttccaaaagttaagccagtgaagcctttcaagc |
7750045 |
T |
|
| Q |
101 |
tatgttttaacttacaggatttgggtgttacaagggttggacctgcagtgccaacaattgactttgtgttacaaaataaggatgttttttggaggatgtt |
200 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7750044 |
tatgttttaacttacagaatttgggtgttacaagggttggacctgcagtgccaacaattgactttgtgttacaaaataaggatgttttttggaggatgtt |
7749945 |
T |
|
| Q |
201 |
tggggcaaattcaatggt |
218 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
7749944 |
tggggcaaattcaatggt |
7749927 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University