View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1718_low_29 (Length: 214)
Name: NF1718_low_29
Description: NF1718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1718_low_29 |
 | |
|
| [»] scaffold0227 (1 HSPs) |
| | |
|
Alignment Details
Target: chr8 (Bit Score: 129; Significance: 6e-67; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 19 - 199
Target Start/End: Original strand, 10862380 - 10862560
Alignment:
| Q |
19 |
aaaatggaggtatatgtggacttcagtccaacacgaaccacttttgttcgacgaggacttttttagtaggtttgaggatcttgatgaccctggccctgag |
118 |
Q |
| |
|
||||||||| ||||||||||||||||| | |||||| ||||| |||||| ||||||||||||| ||||||||||||| ||||| |||||||||| || |
|
|
| T |
10862380 |
aaaatggagctatatgtggacttcagtttgatacgaacaccttttattcgacaaggacttttttagaaggtttgaggatcatgatggccctggcccttag |
10862479 |
T |
|
| Q |
119 |
atttctagaattatcactgaagttcttttccttcacaatgggccgatatatggttttgctcttgacatccctatccctatg |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10862480 |
atttctagaattatcactgaagttcttttccttcacaatgggccgatatatggttttgctcttgacatccctatccctatg |
10862560 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 120 - 169
Target Start/End: Complemental strand, 40011093 - 40011044
Alignment:
| Q |
120 |
tttctagaattatcactgaagttcttttccttcacaatgggccgatatat |
169 |
Q |
| |
|
|||| ||||||||||| |||||||||||||| |||||||| ||||||||| |
|
|
| T |
40011093 |
tttcaagaattatcacggaagttcttttcctccacaatggaccgatatat |
40011044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0227 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: scaffold0227
Description:
Target: scaffold0227; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 71 - 190
Target Start/End: Complemental strand, 3586 - 3467
Alignment:
| Q |
71 |
gaggacttttttagtaggtttgaggatcttgatgaccctggccctgagatttctagaattatcactgaagttcttttccttcacaatgggccgatatatg |
170 |
Q |
| |
|
|||||||| ||| ||||||| ||||||||| |||||||||||||||||||||||||||||||||| ||| ||||||| || |||||||||||||||||| |
|
|
| T |
3586 |
gaggacttcttttgtaggttcgaggatcttaatgaccctggccctgagatttctagaattatcaccgaaattcttttactccacaatgggccgatatata |
3487 |
T |
|
| Q |
171 |
gttttgctcttgacatccct |
190 |
Q |
| |
|
| ||| |||||| |||||| |
|
|
| T |
3486 |
gatttattcttgatatccct |
3467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 111 - 166
Target Start/End: Original strand, 16865530 - 16865585
Alignment:
| Q |
111 |
gccctgagatttctagaattatcactgaagttcttttccttcacaatgggccgata |
166 |
Q |
| |
|
|||||||| ||| || ||||||||| ||||||||||| || ||||||||||||||| |
|
|
| T |
16865530 |
gccctgaggtttgtataattatcacggaagttcttttgctccacaatgggccgata |
16865585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University