View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17190_high_16 (Length: 215)

Name: NF17190_high_16
Description: NF17190
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17190_high_16
NF17190_high_16
[»] chr2 (1 HSPs)
chr2 (18-198)||(26836810-26836990)


Alignment Details
Target: chr2 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 18 - 198
Target Start/End: Original strand, 26836810 - 26836990
Alignment:
18 aataagggagagattggagaggtgaccagttgcatgcgtgaaatggctaagaaggcagtattgatagggtgcaactatcaaggaacaaaggctgagctaa 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
26836810 aataagggagagattggagaggtgaccagttgcatgcgtgaaatggctaagaaggcagtattgatagggtgcaactatccaggaacaaaggctgagctaa 26836909  T
118 aagggtgcattaacgatgtgtggaggatgcacaaatgcctcattcacaaatatggtttctcagataaggatatcactgttc 198  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26836910 aagggtgcattaacgatgtgtggaggatgcacaaatgcctcattcacaaatatggtttctcagataaggatatcactgttc 26836990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University