View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17190_low_17 (Length: 221)
Name: NF17190_low_17
Description: NF17190
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17190_low_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 203
Target Start/End: Original strand, 10689026 - 10689228
Alignment:
| Q |
1 |
atactacaggggataatgatgctaaataagaatcatcacagtagtttacacttttgagtgtacatgaacatagagaagacataactgctgcttttggaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10689026 |
atactacaggggataatgatgctaaataagaaccatcacagtagtttacacttttgagtgtacatgaacatagagaagacataactgctgcttttggaat |
10689125 |
T |
|
| Q |
101 |
accaaaggaattatcacaaattgatttcaaagcgacattgaggccaattgagagtggttcagtcacaaaacttgcctcaaagtttcttctcccttgggat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10689126 |
accaaaggaattatcacaaattgatttcaaagcaacattgaggccaattgagagtggttcagtcacaaaacttgcctcaaagtttcttctcccttgggat |
10689225 |
T |
|
| Q |
201 |
ccc |
203 |
Q |
| |
|
||| |
|
|
| T |
10689226 |
ccc |
10689228 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 5 - 113
Target Start/End: Complemental strand, 43560373 - 43560265
Alignment:
| Q |
5 |
tacaggggataatgatgctaaataagaatcatcacagtagtttacacttttgagtgtacatgaacatagagaagacataactgctgcttttggaatacca |
104 |
Q |
| |
|
||||||||||| ||||||| ||||||| |||||||||| ||||||||||| ||||||||||||||||| |||||| ||||||| |||| |||||| ||| |
|
|
| T |
43560373 |
tacaggggatagagatgctatataagaaccatcacagtactttacactttttagtgtacatgaacatagggaagacgtaactgcagcttctggaatgcca |
43560274 |
T |
|
| Q |
105 |
aaggaatta |
113 |
Q |
| |
|
||||||||| |
|
|
| T |
43560273 |
aaggaatta |
43560265 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University