View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17191_low_5 (Length: 348)
Name: NF17191_low_5
Description: NF17191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17191_low_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 165; Significance: 3e-88; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 1 - 193
Target Start/End: Original strand, 21283287 - 21283479
Alignment:
| Q |
1 |
tggggagattcctcaggtggagtccttgcttaatcaaggacctactgctttttcaggaaacccaggactttgtgggtttccgttaaggaacctttgtcca |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||| | |
|
|
| T |
21283287 |
tggggagattcctcaggtggggtccttgcttaatcaaggacctactgctttttcaggaaacccaggactttgtgggtttccgttgaggaatctttgtcaa |
21283386 |
T |
 |
| Q |
101 |
gatgagacaaaggttcctgattatttaccggagaatccggatactaacccgaatgcagttcggactgaaccagttcaagatgggagggggagg |
193 |
Q |
| |
|
|| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
21283387 |
gacgagacaaaggttcctgactatttaccggagaatccggatactaacccgaatgcagttcggactgaaccggttcaagatgggagggggagg |
21283479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 269 - 333
Target Start/End: Original strand, 21283555 - 21283619
Alignment:
| Q |
269 |
aggaggcggcggaggaggttgaatgatggggaagttgggtttgaaaaggggaaggtggagggtga |
333 |
Q |
| |
|
|||||||| |||||||||||||||||| |||||| |||||||||||||||||| ||||| ||||| |
|
|
| T |
21283555 |
aggaggcgacggaggaggttgaatgatagggaaggtgggtttgaaaaggggaaagtggaaggtga |
21283619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University