View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17195_high_26 (Length: 263)
Name: NF17195_high_26
Description: NF17195
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17195_high_26 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 20 - 249
Target Start/End: Complemental strand, 13767486 - 13767257
Alignment:
| Q |
20 |
cctggcgctccaccagactaaaatttgagttgtgacattcatgtatttggtctgcataaatgaactcatcggctttttgtagtagttcttgttcaagctt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13767486 |
cctggcgctccaccagactaaaatttgagttgtgacattcatgtatttggtctgcataaatgaactcatcggctttttgtagtagttcttgttcaagctt |
13767387 |
T |
 |
| Q |
120 |
ctcgactttggaaatcgcttcttgtatttgattgacttgcacatcatgtgatctcttcaagttcttatatgaacgctttttacctctaagttctgccttg |
219 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13767386 |
ctcggctttggaaatcgcttcttgtatttgattgacttgcacatcatgtgatctcttcaagttcttatatgaacgctttttacctctaagttctgccttg |
13767287 |
T |
 |
| Q |
220 |
agtttcttaatttcacctttagcttcatct |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
13767286 |
agtttcttaatttcacctttagcttcatct |
13767257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University