View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17195_low_30 (Length: 258)
Name: NF17195_low_30
Description: NF17195
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17195_low_30 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 17 - 251
Target Start/End: Complemental strand, 37925460 - 37925218
Alignment:
| Q |
17 |
attcataagcataacggcagaaacaagggtatgcctgtaatatagtttccattctaacagtaaaaatgtgtttattggagcctttcttttctcaaatttt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
37925460 |
attcataagcataacggcagaaacaagggtaagcctgtaatatagtttccattctaacagtaaaaatgtgtttattggagcttttcttttctcaaatttt |
37925361 |
T |
 |
| Q |
117 |
gcaggctaaggcttaatgaaagaacaaggagtcatggactggttaatttagctct--------cagatgattatgtttgttaaacttaactatacttatt |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
37925360 |
gcaggctaaggcttaatgaaagaacaaggagtcatggactggttaatttagctctcagactctcagatgattgtgtttgttaaacttaactatacttatt |
37925261 |
T |
 |
| Q |
209 |
aatgcatcaataacattaagcttacccacaaaaagaataatct |
251 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
37925260 |
aatgcatcaataacaataagcttacccacaaaaagaataatct |
37925218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University