View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17195_low_31 (Length: 250)
Name: NF17195_low_31
Description: NF17195
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17195_low_31 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 5 - 250
Target Start/End: Original strand, 13766992 - 13767235
Alignment:
| Q |
5 |
ggtatattatactgacttgaaaaagttatttatgtgaatatctttgacatatgttattgatattatatagtttacctagatagtatgaaatatatggatt |
104 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
13766992 |
ggtacattataatgacttgaaaaagttatttatgtgaatatctttgacatatgttattgatattatatagtttacctagatagtatgaaatatatggaat |
13767091 |
T |
|
| Q |
105 |
atgttctcaaactctgttcaaatcatgtttcatataaccaccaacttttggcctctttagctgcaaacttcaatgttactaactgtcattgtctatttct |
204 |
Q |
| |
|
|||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13767092 |
atgttctcaaactcagttcaaatcatgtttc--ataaccaccaacttttggcctctttagctgcaaacttcaatgttactaactgtcattgtctatttct |
13767189 |
T |
|
| Q |
205 |
ttttatttataggtagcaaacaagttttttgaatgtagaaaacaat |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13767190 |
ttttatttataggtagcaaacaagttttttgaatgtagaaaacaat |
13767235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University