View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17196_high_19 (Length: 327)
Name: NF17196_high_19
Description: NF17196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17196_high_19 |
 | |
|
| [»] scaffold0137 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0137 (Bit Score: 139; Significance: 1e-72; HSPs: 2)
Name: scaffold0137
Description:
Target: scaffold0137; HSP #1
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 165 - 311
Target Start/End: Complemental strand, 4953 - 4807
Alignment:
| Q |
165 |
gttgtgattgtttgaaggatattgctacggcggatcttcgatcttctcatcctataagattgggtttggctttgaatttctcggttttctattatgaaat |
264 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4953 |
gttgtgattgtttgaaggatattgctgctgcggatcttcgatcttctcatcctataagattgggtttggctttgaatttctcggttttctattatgaaat |
4854 |
T |
|
| Q |
265 |
tcttaaccggtttgacgaaggtcttgacatggctagacaggtttgtg |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4853 |
tcttaaccggtttgacgaaggtcttgacatggctagacaggtttgtg |
4807 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0137; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 1 - 72
Target Start/End: Complemental strand, 5115 - 5044
Alignment:
| Q |
1 |
ctgagtttaagattggtgatgacaaaaaatctgctgttgaggatattattttgtcttacaaggctgcacagg |
72 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
5115 |
ctgagtttaagattggtgatgacaaaaaatctgctgttgaggatattatcttgtcttacaaggctgcacagg |
5044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 139; Significance: 1e-72; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 165 - 311
Target Start/End: Complemental strand, 3897297 - 3897151
Alignment:
| Q |
165 |
gttgtgattgtttgaaggatattgctacggcggatcttcgatcttctcatcctataagattgggtttggctttgaatttctcggttttctattatgaaat |
264 |
Q |
| |
|
|||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3897297 |
gttgtgattgtttgaaggatattgctgcggcagatcttcgatcttctcatcctataagattgggtttggctttgaatttctcggttttctattatgaaat |
3897198 |
T |
|
| Q |
265 |
tcttaaccggtttgacgaaggtcttgacatggctagacaggtttgtg |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3897197 |
tcttaaccggtttgacgaaggtcttgacatggctagacaggtttgtg |
3897151 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 1 - 72
Target Start/End: Complemental strand, 3898784 - 3898713
Alignment:
| Q |
1 |
ctgagtttaagattggtgatgacaaaaaatctgctgttgaggatattattttgtcttacaaggctgcacagg |
72 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3898784 |
ctgagtttaagattggtgatgacaaaaaatctgctgttgaggatattatcttgtcttacaaggctgcacagg |
3898713 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 179 - 267
Target Start/End: Original strand, 46283646 - 46283734
Alignment:
| Q |
179 |
aaggatattgctacggcggatcttcgatcttctcatcctataagattgggtttggctttgaatttctcggttttctattatgaaattct |
267 |
Q |
| |
|
|||||||||||| | |||||||||| ||| |||||||||||||||||||||||||| | |||||||| ||||||||||| |||||||| |
|
|
| T |
46283646 |
aaggatattgctgctgcggatcttccatcaactcatcctataagattgggtttggctctcaatttctctgttttctattacgaaattct |
46283734 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 1 - 72
Target Start/End: Original strand, 46283500 - 46283571
Alignment:
| Q |
1 |
ctgagtttaagattggtgatgacaaaaaatctgctgttgaggatattattttgtcttacaaggctgcacagg |
72 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| |||||||| ||| ||||||||||| |||||||||| |
|
|
| T |
46283500 |
ctgagtttaagattggtgatgagaaaaaatctgctgctgaggatactatgttgtcttacaaagctgcacagg |
46283571 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 224 - 261
Target Start/End: Complemental strand, 39356450 - 39356413
Alignment:
| Q |
224 |
ttgggtttggctttgaatttctcggttttctattatga |
261 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
39356450 |
ttgggtctggctttgaatttctcagttttctattatga |
39356413 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University