View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17196_high_23 (Length: 277)
Name: NF17196_high_23
Description: NF17196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17196_high_23 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 77 - 201
Target Start/End: Original strand, 19750973 - 19751097
Alignment:
| Q |
77 |
aaaatggtagagatcgtataagagagggaaaatgcaaaactgaaaaatagaaattgtgttttattgctatgactttggtaaaataatgaattaaattaac |
176 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
19750973 |
aaaatggtagagatcatataagagagggaaaatgcaaaactgaaaaatagaaattgtgttttattgctatgactttggtaaaataatgaattatattaac |
19751072 |
T |
 |
| Q |
177 |
aaaaggcaccagggatgccaaataa |
201 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
19751073 |
aaaaggcaccagggatgccaaataa |
19751097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University