View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17196_high_24 (Length: 274)
Name: NF17196_high_24
Description: NF17196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17196_high_24 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 1 - 259
Target Start/End: Original strand, 46873154 - 46873412
Alignment:
| Q |
1 |
tttgtcaatggttgtttctgtggtttttcaaccttctttgtcagaggatatagtgaaaagggttggtgagaaatgtcataaagttcaagatttgaatgga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46873154 |
tttgtcaatggttgtttctgtggtttttcaaccttctttgtcagaggatatagtgaaaagggttggtgagaaatgtcataaagttcaagatttgaatgga |
46873253 |
T |
|
| Q |
101 |
aagttgaagtttttgcagaaggaattgggagggattgtgaatggaaaagtttctaactgtagctttattgataaatcatggaaaatcaaccaggtactgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46873254 |
aagttgaagtttttgcagaaggaattgggagggattgtgaatggaaaagtttctaactgtagctttattgataaatcatggaaaatcaaccaggtactgt |
46873353 |
T |
|
| Q |
201 |
attgtttgtagaatttatctgaaaaagtttcttgatttgttaaagaactagtatgaatg |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46873354 |
attgtttgtagaatttatctgaaaaagtttcttgatttgttaaagaactagtatgaatg |
46873412 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University