View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17196_high_25 (Length: 261)
Name: NF17196_high_25
Description: NF17196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17196_high_25 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 12 - 246
Target Start/End: Complemental strand, 1008615 - 1008381
Alignment:
| Q |
12 |
ttctttggatcccttatctccgcagcaaatttcccccatggccttcacctcacacctctatacctcttccattctggtattggagtgtgaggtttatgga |
111 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
1008615 |
ttctttggatcccttatctctgcagcaaatttcccccatggccttcgcctcacacctctatacctcttccattctggtattggaatgtgaggtttatgga |
1008516 |
T |
 |
| Q |
112 |
tcatcgatgatgatccatttttacacgcggcatcatcaacattgtcagtgttgttaacaaccaatgttggactagtaaatgaatcgtgcgaggatggatc |
211 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1008515 |
tcatcgatgatgatccatttttacatgcggcatcattaacattgtcagtgttgttaacaaccaatgttggactagtaaatgaatcgtgcgaggatggatc |
1008416 |
T |
 |
| Q |
212 |
tgaggcatggtgggtggaattagtattcatgatga |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
1008415 |
tgaggcatggtgggtggaattagtattcatgatga |
1008381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 17 - 73
Target Start/End: Complemental strand, 18652950 - 18652894
Alignment:
| Q |
17 |
tggatcccttatctccgcagcaaatttcccccatggccttcacctcacacctctata |
73 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
18652950 |
tggatcccttatctcagctgcaaatttcccccatggccttctccttacacctctata |
18652894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 21 - 57
Target Start/End: Original strand, 19720012 - 19720048
Alignment:
| Q |
21 |
tcccttatctccgcagcaaatttcccccatggccttc |
57 |
Q |
| |
|
|||||||||||||| || ||||||||||||||||||| |
|
|
| T |
19720012 |
tcccttatctccgccgcgaatttcccccatggccttc |
19720048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University