View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17196_high_33 (Length: 243)
Name: NF17196_high_33
Description: NF17196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17196_high_33 |
 |  |
|
| [»] scaffold0041 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0041 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: scaffold0041
Description:
Target: scaffold0041; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 6 - 227
Target Start/End: Original strand, 12603 - 12817
Alignment:
| Q |
6 |
gagagatgaaaattgagaaaacataatttatcagattgtaaaatttatttttacaatctaaaataaatcagaccaaatttatggttcacacatttgagat |
105 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
12603 |
gagatatgaaaattgagaaaacataatttatcggattgtaaaatttatttttacaatctaaaataaatcagaccaaatttatggtt--cacatttgagat |
12700 |
T |
 |
| Q |
106 |
gaattttgcactatgcaaaagcttatattctcttgaatcaacaaatctctttgttaaatcaaatatgatatgatgtgatttattgattaaatgttgaaaa |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
12701 |
aaattttgcactatgcaaaagcttatattctcttgaatcaacaaatctctttgttaaatcaaatatgata-----tgatttattgattaaatgctgaaaa |
12795 |
T |
 |
| Q |
206 |
ataaagttgtgtacggtgtaaa |
227 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
12796 |
ataaagttgtgtacggtgtaaa |
12817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 148 - 189
Target Start/End: Original strand, 42172388 - 42172429
Alignment:
| Q |
148 |
aaatctctttgttaaatcaaatatgatatgatgtgatttatt |
189 |
Q |
| |
|
||||||| | ||||||||||||| |||||||||||||||||| |
|
|
| T |
42172388 |
aaatctcatcgttaaatcaaataagatatgatgtgatttatt |
42172429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University