View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17196_high_46 (Length: 209)
Name: NF17196_high_46
Description: NF17196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17196_high_46 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 117; Significance: 8e-60; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 117; E-Value: 8e-60
Query Start/End: Original strand, 31 - 160
Target Start/End: Complemental strand, 30275533 - 30275402
Alignment:
| Q |
31 |
ataatactaggacataacatat--ttgattgacaataatcaggccattgcagaagacatttctccattagttgaacttgaaatgggaaatttagttatta |
128 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30275533 |
ataatactaggacataacatatatttgattgacaataatcaggccattgcagaagacatttctccattagttgaacttgaaatgggaaatttagttatta |
30275434 |
T |
|
| Q |
129 |
gcggactcaaaaatctctttaatgagtatatt |
160 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| |
|
|
| T |
30275433 |
gcggactcaagaatctctttaatgagtatatt |
30275402 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 86; Significance: 3e-41; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 31 - 151
Target Start/End: Complemental strand, 7778844 - 7778724
Alignment:
| Q |
31 |
ataatactaggacataacatatttgattgacaataatcaggccattgcagaagacatttctccattagttgaacttgaaatgggaaatttagttattagc |
130 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
7778844 |
ataatactagtacataacatatttgattgacaataatcaggccgttgcagaagacatttctccattagttgaacttgaaat-ggaaatttagtcattagt |
7778746 |
T |
|
| Q |
131 |
ggactcaa-aaatctctttaat |
151 |
Q |
| |
|
|||||||| |||||||||||| |
|
|
| T |
7778745 |
ggactcaaggaatctctttaat |
7778724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University