View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17196_low_32 (Length: 250)
Name: NF17196_low_32
Description: NF17196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17196_low_32 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 8 - 250
Target Start/End: Original strand, 28938469 - 28938711
Alignment:
| Q |
8 |
cgaagaaaatatgagaaattggtcatcaggatgaagtttatgtgttgaaattgatggctcacagctgagaattggtttgaaaaatgtttcagcaagtctg |
107 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
28938469 |
cgaagcaaatatgagaaattggtcatcaggatgaagtttatgtgttgaaattgatggctcacagctgagaattggtttgaaaaatgtttcagcgagtctg |
28938568 |
T |
|
| Q |
108 |
aactttgatggtagaggctccctattgaattctgctttcttcagatatgcatcaccgatcgatcgcgaaacctgcaaaaagcatgtagttttgtaaattt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28938569 |
aactttgatggtagaggctccctattgaattctgctttcttcagatatgcatcaccgatcgatcgcgaaacctgcaaaaagcatgtagttttgtaaattt |
28938668 |
T |
|
| Q |
208 |
taaggactgaagtggatacaaagactaataacaggaattataa |
250 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
28938669 |
taaggactgaggtggatacaaagactaataacaggaattataa |
28938711 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 9 - 187
Target Start/End: Original strand, 40325773 - 40325951
Alignment:
| Q |
9 |
gaagaaaatatgagaaattggtcatcaggatgaagtttatgtgttgaaattgatggctcacagctgagaattggtttgaaaaatgtttcagcaagtctga |
108 |
Q |
| |
|
|||| ||| ||||||||||| || ||||| || | |||||| ||| ||||||||||||| ||||||||||| |||||||| ||||||| ||||| | |
|
|
| T |
40325773 |
gaagcaaagatgagaaattgatcttcaggttggattttatgaactgatattgatggctcactactgagaattggcttgaaaaaggtttcaggcagtctaa |
40325872 |
T |
|
| Q |
109 |
actttgatggtagaggctccctattgaattctgctttcttcagatatgcatcaccgatcgatcgcgaaacctgcaaaaa |
187 |
Q |
| |
|
|||| ||| |||||||| || || ||||||||||||||||||||||||||||| || |||| |||||||||||||| |
|
|
| T |
40325873 |
acttctgtggcagaggctctctgttaaattctgctttcttcagatatgcatcacctatggatcttgaaacctgcaaaaa |
40325951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University