View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17196_low_33 (Length: 250)
Name: NF17196_low_33
Description: NF17196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17196_low_33 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 1 - 86
Target Start/End: Complemental strand, 40224044 - 40223959
Alignment:
| Q |
1 |
aatttagaaccaaaaaactttatatgtgtgaattagataaaactaggatatggataaatcgatacaactaattagacttaggtgca |
86 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
40224044 |
aatttagaacgaaaaaactttatatgtgtgaattagataaaactaggatatcgataaatcgatacaactaattagacttaggtgca |
40223959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 151 - 237
Target Start/End: Complemental strand, 40223894 - 40223808
Alignment:
| Q |
151 |
ataccagcacttactatattttttaagttaatgtannnnnnnggttcgggttgatgtctgactaattaataatatttggtccttgtt |
237 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40223894 |
ataccagcacttactatatttttgaagttaatgtatttttttggttcgggttgatgtctgactaattaataatatttggtccttgtt |
40223808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University