View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17196_low_36 (Length: 244)
Name: NF17196_low_36
Description: NF17196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17196_low_36 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 14 - 231
Target Start/End: Original strand, 8030965 - 8031182
Alignment:
| Q |
14 |
aaatttattggtcttgtagggaattataatggaggagcaaatggacactttcaacattcctcagtacacaccatctccatcagaagtaaaattagaggtt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8030965 |
aaatttattggtcttgtagggaattataatggaggagcaaatggacactttcaacattcctcagtacacaccatctccatcagaagtaaaattagaggtt |
8031064 |
T |
 |
| Q |
114 |
ttgagagaagggtcattcactattgatcgtctggaagtaacagaagtacattggaatgcttataatgattggaatgagattgattttagaagtagtttat |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
8031065 |
ttgagagaagggtcattcactattgatcgtctggaagtaacagaagtacattggaatgcttataatgattggaatgaggttgattttagaagtagtttat |
8031164 |
T |
 |
| Q |
214 |
ctaaatcactcattgatg |
231 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
8031165 |
ctaaatcactcattgatg |
8031182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University