View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17196_low_39 (Length: 241)
Name: NF17196_low_39
Description: NF17196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17196_low_39 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 126; Significance: 4e-65; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 16 - 161
Target Start/End: Complemental strand, 19077536 - 19077391
Alignment:
| Q |
16 |
atgaacaaccatatatgacgattccttaatcaccttttatatcacttcactttaatataagttaacgtcttttaggaaattctgatcaatcaatctccca |
115 |
Q |
| |
|
||||||||||| | ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
19077536 |
atgaacaaccagacatggcgattccttaatcaccttttatatcacttcactttaatataagttaacgtcttctacgaaattctgatcaatcaatctccca |
19077437 |
T |
|
| Q |
116 |
tgataatctctccaatgattccataataatcttggcataggatatc |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19077436 |
tgataatctctccaatgattccataataatcttggcataggatatc |
19077391 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 16 - 161
Target Start/End: Complemental strand, 19079261 - 19079116
Alignment:
| Q |
16 |
atgaacaaccatatatgacgattccttaatcaccttttatatcacttcactttaatataagttaacgtcttttaggaaattctgatcaatcaatctccca |
115 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| || |||||| |||||||||||||||||| |
|
|
| T |
19079261 |
atgaacaatcaaatatgacgattccttaatcaccttttacatcacttcactttaatataagttaacgtcttctacgaaattttgatcaatcaatctccca |
19079162 |
T |
|
| Q |
116 |
tgataatctctccaatgattccataataatcttggcataggatatc |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19079161 |
tgataatctctccaatgattccataataatcttggcataggatatc |
19079116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University