View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17196_low_41 (Length: 229)
Name: NF17196_low_41
Description: NF17196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17196_low_41 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 208; Significance: 1e-114; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 10 - 229
Target Start/End: Complemental strand, 42086156 - 42085937
Alignment:
| Q |
10 |
aagaatatatcagaaataatacatagtttatggttaggttgttgggttaagatgttttggatgatgtttttgaaggaaggttttaaggaaagagaagctt |
109 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
42086156 |
aagaaaatatcagaaataatacatagtttatggttaggttgttgggttaagatgttttggatgatgtatttgaaggaaggttttaaggaaagagaagctt |
42086057 |
T |
|
| Q |
110 |
ggatgagtttgatgacaagattgtaagggacagtatcagtgttttctgtgttgggtgggagattatggtcggaagagatgaaagggattgtgaggatatt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
42086056 |
ggatgagtttgatgacaagattgtaagggacagtatcagtgttttctgtgttgggtgggagattatggtcggaagagatgaaagggattgtgaggagatt |
42085957 |
T |
|
| Q |
210 |
gatggaggaatttggtggga |
229 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
42085956 |
gatggaggaatttggtggga |
42085937 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 48 - 229
Target Start/End: Complemental strand, 42081895 - 42081714
Alignment:
| Q |
48 |
ttgttgggttaagatgttttggatgatgtttttgaaggaaggttttaaggaaagagaagcttggatgagtttgatgacaagattgtaagggacagtatca |
147 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||| ||||||||||||||||||| ||| || ||||||||||||||||| |||| ||||| ||| |
|
|
| T |
42081895 |
ttgtttggttatgatgttttggatgatgtttttgaaggatggttttaaggaaagagaagtttgtatacgtttgatgacaagattgcaaggaacagtctca |
42081796 |
T |
|
| Q |
148 |
gtgttttctgtgttgggtgggagattatggtcggaagagatgaaagggattgtgaggatattgatggaggaatttggtggga |
229 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||||| ||||||||||||||||||| ||||||| |||| || ||||||| |
|
|
| T |
42081795 |
atgttttctgtgttgagtgggaggttatggtcggaagaaatgaaagggattgtgaggaaattgatgtaggagttaggtggga |
42081714 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University