View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17196_low_42 (Length: 228)
Name: NF17196_low_42
Description: NF17196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17196_low_42 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 18 - 216
Target Start/End: Complemental strand, 51068591 - 51068393
Alignment:
| Q |
18 |
actattttgacaactttttaattaaaatgaaatctatgttggtagaccatgtaatgatataatcaaatcatcattgtggtttttgtttgtttctaataat |
117 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51068591 |
actattatgacaactttttaattaaaatgaaatctatgttggtagaccatgtaatgatataatcaaatcatcattgtggtttttgtttgtttctaataat |
51068492 |
T |
 |
| Q |
118 |
gtggtctattcatttgagttctgttatcatggatttgaataagggattttctttgaagggttataatctattgtgattttttaaaaacaatgatattct |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
51068491 |
gtggtctattcatttgagttctgttatcatggatttgaataagggattttctttgaagggttataatctattgtgattttttaaaaacaaggatattct |
51068393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University