View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17196_low_46 (Length: 216)

Name: NF17196_low_46
Description: NF17196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17196_low_46
NF17196_low_46
[»] chr4 (1 HSPs)
chr4 (1-200)||(55493719-55493918)


Alignment Details
Target: chr4 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 200
Target Start/End: Complemental strand, 55493918 - 55493719
Alignment:
1 ccctccgttctcaaaacccctttcacgatcatcgatggtcctccaagctccgccgccggcaaccccggttttcaccttttctctcgtccacaattctcaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
55493918 ccctccgttctcaaaacccctttcacgatcatcgatggtcctccaagctccgccgccggcaaccccggttttcaccttttctctcgtccacaattctcaa 55493819  T
101 tttctcgtcaaattctcgaattccctttaattattcgattttatcgtttctgcagatgaaattgcaaagctgttcccgaatctgttcgggcaatcgtctg 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
55493818 tttctcgtcaaattctcgaattccctttaattattcgattttatcgtttctgcagatgaaattgcaaagctgttcccgaatctgttcgggcaatcgtctg 55493719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University