View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17196_low_49 (Length: 210)
Name: NF17196_low_49
Description: NF17196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17196_low_49 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 17 - 192
Target Start/End: Complemental strand, 43410397 - 43410225
Alignment:
| Q |
17 |
cataggtaatttgtttcctgcatgggtctgactgcaagcagagggtggggatttcaaactagtaactattccatctccatggttattattatagaagcta |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43410397 |
cataggtaatttgtttcctgcatgggtctgactgcaagcagagggtggggatttcaaactagtaactattccatctccatggttattattatagaagcta |
43410298 |
T |
 |
| Q |
117 |
ttgttgttgttgttatcattaccatcaccaccattagcagttgcagtgctcaactctgggaagctggcatagaaag |
192 |
Q |
| |
|
|| |||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
43410297 |
tt---gttgctgttatcattaccatcaccaccattagcagttgcattgctcaactctgggaagctggcatagaaag |
43410225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University