View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17198_high_31 (Length: 321)
Name: NF17198_high_31
Description: NF17198
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17198_high_31 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 45 - 321
Target Start/End: Complemental strand, 4872476 - 4872200
Alignment:
| Q |
45 |
caagtggatggctcttttagtttcacctatctcacataagctaccgactagatgatgataagtttacagctcaaccgaaaaccaccctttaggaagatgt |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4872476 |
caagtggatggctcttttagtttcacctatctcacataagctaccgactagatgatgataagtttacagctcaaccgaaaaccaccctttaggaagatgt |
4872377 |
T |
|
| Q |
145 |
aattgtgtaagagcattgctttgtaaatgtggcctggggctaaaagacaacagaaaagatcatacatattggaagaactgggacgaagaccagcgttgat |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
4872376 |
aattgtgtaagagcattgctttgtaaatgtggcctggggctaaaagacaacagaaaagatcatacatatcggaagaactgggacgatgaccagcgttgat |
4872277 |
T |
|
| Q |
245 |
gattttgcggaaaagagagaaagctgaagagatgtgaccgtttttagcgtgacaagagatgaagattaaccaagtat |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
4872276 |
gattttgcggaaaagagagaaagctgaagagatgtgaccgtttttagcgtgacaagagatgaggattaaccaagtat |
4872200 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University