View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17198_low_29 (Length: 339)
Name: NF17198_low_29
Description: NF17198
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17198_low_29 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 18 - 332
Target Start/End: Original strand, 7254190 - 7254498
Alignment:
| Q |
18 |
gaaatgtccaatttgtcctgtggcctcagattcttcttacaaacaggtacttcaaattttatttattgacaataagtacttattaattgattacttcatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7254190 |
gaaatgtccaatttgtcctgtggcctcagattcttcttacaaacaggtacttcaaattttatttattgacaataagtacttattaattgattacttcatt |
7254289 |
T |
 |
| Q |
118 |
caattnnnnnnnnnnnnnnntgtaggatatatcatttctacttaattggtgtgaattgtttatatgtttaaaatttgatcagatggaagttctggcagtg |
217 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7254290 |
caatttatatatat------tgtaggatatatcatttctacttaattggtgtgaattgtttatatgtttaaaatttgatcagatggaagttctggcagtg |
7254383 |
T |
 |
| Q |
218 |
agcttatcatatctaatttatgatctagtgtgttgtttatttgatgaaaaattcaattgggacaacactatccaccatttggtaagcattgttggactca |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7254384 |
agcttatcatatctaatttatgatctagtgtgttgtttatttgatgaaaaattcaattgggacaacactatccaccatttggtaagcattgttggactca |
7254483 |
T |
 |
| Q |
318 |
tagctggcctatgct |
332 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
7254484 |
tagctggcctatgct |
7254498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University