View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17198_low_32 (Length: 319)
Name: NF17198_low_32
Description: NF17198
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17198_low_32 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 104 - 237
Target Start/End: Original strand, 29487755 - 29487888
Alignment:
| Q |
104 |
ggcagagtcgtcggagggttcatcggagggatcgagttcagattttccgtcattggagggagtagtggtagtaacaggaggcgcctctattaattccatt |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29487755 |
ggcagagtcgtcggagggttcatcggagggatcgagttcagattttccgtcattggagggagtagtggtagtaacaggaggcgcctctattaattccatt |
29487854 |
T |
 |
| Q |
204 |
tcaaccacggtggagacagcgggtggttcgacgg |
237 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |
|
|
| T |
29487855 |
tcaaccacggtggaggcagcgggtggttcgacgg |
29487888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 234 - 307
Target Start/End: Original strand, 29487861 - 29487934
Alignment:
| Q |
234 |
acggcggaggaagcgggtggttcgacggagggtgcgactgttgttgtgacggttgaaggttctatcatttcttc |
307 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||| || ||||||||||||||||||||| || ||||||||||| |
|
|
| T |
29487861 |
acggtggaggcagcgggtggttcgacggagggtccggttgttgttgtgacggttgaaggatcaatcatttcttc |
29487934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University