View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17198_low_40 (Length: 274)
Name: NF17198_low_40
Description: NF17198
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17198_low_40 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 10 - 250
Target Start/End: Complemental strand, 44474463 - 44474222
Alignment:
| Q |
10 |
catcatca-catccaaactcaacctcagaacttgtgcttcagggttagggtttcttacacgatcattctcctctgaaccgggaaagagattcgctgcgtt |
108 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44474463 |
catcatcatcatccaaactcaacctcagaacttgtgcttcagggttagggtttcttacacgatcattctcctctgaaccgggaaagagattcgctgcgtt |
44474364 |
T |
|
| Q |
109 |
atggggcaacggcgattacggtagattgggtctcggtaatttgaattctcaatggaaacctgctatttgcacctccttccataatcaaaacgttcaagca |
208 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44474363 |
atggggcaacggtgattacggtagattgggtctcggtaatttgaattctcaatggaaacctgctatttgcacctccttccataatcaaaacgttcaagca |
44474264 |
T |
|
| Q |
209 |
attgcttgtggtggcgctcacacgctatttttaacaggttca |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44474263 |
attgcttgtggtggcgctcacacgctatttttaacaggttca |
44474222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University