View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17198_low_43 (Length: 247)
Name: NF17198_low_43
Description: NF17198
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17198_low_43 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 220; Significance: 1e-121; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 30723036 - 30722801
Alignment:
| Q |
1 |
cttgtctatgcttaatttctgcatgttaacaatgatccaatatcaagtatcaaaacagtatgatcatgcatgcattacttaaatcaaaattttcttt-ga |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | || |
|
|
| T |
30723036 |
cttgtctatgcttaatttctgcatgttaacaatgatccaatatcaagtatcaaaacagtatgatcatgcatgcattacttaaatcaaaattttctctaga |
30722937 |
T |
 |
| Q |
100 |
caattttgataataaagaataaagaatcaaacccatctaaatgcctctaattgaaacatgcaatatttgaaacatttgtggaaacaagtggttctcacct |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
30722936 |
caattttgataataaagaataaagaatcaaacccatctaaatgcctctaattgaaacatgcaatatttgaaacatttgtggaaacaagaggttctcacct |
30722837 |
T |
 |
| Q |
200 |
ttgtgtagaaacaagaagaaaaatgatgatcaaagt |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
30722836 |
ttgtgtagaaacaagaagaaaaatgatgatcaaagt |
30722801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 20 - 52
Target Start/End: Complemental strand, 30723069 - 30723037
Alignment:
| Q |
20 |
tgcatgttaacaatgatccaatatcaagtatca |
52 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
30723069 |
tgcatgttaacaatgatccaatatcaagtatca |
30723037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University