View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17198_low_47 (Length: 219)
Name: NF17198_low_47
Description: NF17198
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17198_low_47 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 69 - 203
Target Start/End: Original strand, 37294512 - 37294645
Alignment:
| Q |
69 |
tcagatattgccatatacttacaaattacaatgttagtgattgatttgttagaggaggaaaaagtgtctctgtcagtaacat--atcgagccctaaactt |
166 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||| || |||||||||| ||||||| |||| ||| |
|
|
| T |
37294512 |
tcagatattgccatatatttacaaattacaatgttagtgattgatttgtta---gaggaaaaagtgtcactttcagtaacatgaatcgagctctaatctt |
37294608 |
T |
 |
| Q |
167 |
cttacatatacctaactcctttaatattctaattcat |
203 |
Q |
| |
|
|||| |||||||||||||||| |||| |||||||||| |
|
|
| T |
37294609 |
cttagatatacctaactccttcaatactctaattcat |
37294645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University