View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17199_high_24 (Length: 337)

Name: NF17199_high_24
Description: NF17199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17199_high_24
NF17199_high_24
[»] chr3 (1 HSPs)
chr3 (267-321)||(42206967-42207024)


Alignment Details
Target: chr3 (Bit Score: 44; Significance: 5e-16; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 267 - 321
Target Start/End: Original strand, 42206967 - 42207024
Alignment:
267 aatttgttatgagcagtgggcatc---atggctctgtaagatattagctctgagaata 321  Q
    ||||||||||||||||||||||||   |||||||||||||||||||||||||||||||    
42206967 aatttgttatgagcagtgggcatcatcatggctctgtaagatattagctctgagaata 42207024  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University