View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17199_high_26 (Length: 329)
Name: NF17199_high_26
Description: NF17199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17199_high_26 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 252; Significance: 1e-140; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 52 - 319
Target Start/End: Complemental strand, 10576624 - 10576358
Alignment:
| Q |
52 |
tttatgaccaatatatggatatccctgatagccacaaaaatagttttaaatgtttaagacaatgcaaatgtacatcaaagggtccccagaggctaactaa |
151 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
10576624 |
tttatgaccaatatatggatatccctgatagccacgaaaatagttttaaatgtttaagacaatgcaaatgtacatcaaagggtccc-agaggctaactaa |
10576526 |
T |
|
| Q |
152 |
ctctcaattgagaggctttgtgacttgaattgggtgcatatatgaggatgcatgaattgtgacaagaactcttttctcctctcctctgttattccttttc |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10576525 |
ctctcaattgagaggctttgtgacttgaattgggtgcatatatgaggatgcatgaattgtgacaagaactcttttctcctctcctctgttattccttttc |
10576426 |
T |
|
| Q |
252 |
cttcaaaattttgaacattctgcaccttttgcgcattttgtacactaagatcttctgttattcctttg |
319 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10576425 |
cttcaaaattctgaacattctgcaccttttgcgcattttgtacactaagatcttctgttattcctttg |
10576358 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 19 - 61
Target Start/End: Complemental strand, 10576893 - 10576851
Alignment:
| Q |
19 |
caagaatctaaaatcaacttacagaacaatacttttatgacca |
61 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10576893 |
caagaatctaaaatcaacttacagaacaatacttttatgacca |
10576851 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University