View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17199_high_28 (Length: 323)
Name: NF17199_high_28
Description: NF17199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17199_high_28 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 25 - 306
Target Start/End: Original strand, 42929067 - 42929348
Alignment:
| Q |
25 |
cattgaacatctcttctcttctcaaaaacacagaactcaaatattcatcttcttcttcatcatggccatggccatattgtcaccaaccaaaaacactctc |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42929067 |
cattgaacatctcttctcttctcaaaaacacagaactcaaatattcatcttcttcttcatcatggccatggccatattgtcaccaaccaaaaacactctc |
42929166 |
T |
|
| Q |
125 |
ttttagagctgataacatcaacaaagatgacactttcaaaaccattaactcagtttacttggacgcttctgaatccttctccactgtttctccaaactgt |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
42929167 |
ttttagagctgataacatcaacaaagatgacactttcaaaaccattaactcagtttacttggatgcttctgaatccttctccactgtttctccaaactgt |
42929266 |
T |
|
| Q |
225 |
gattctagcttttcaaaagcttctaatgatcaagaatccaaacaagttgattcgatcgaaactgtgattcgtggattatctt |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42929267 |
gattctagcttttcaaaagcttctaatgatcaagaatccaaacaagttgattcgatcgaaactgtgattcgtggattatctt |
42929348 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 78 - 133
Target Start/End: Complemental strand, 25531550 - 25531495
Alignment:
| Q |
78 |
tcttcatcatggccatggccatattgtcaccaaccaaaaacactctcttttagagc |
133 |
Q |
| |
|
||||| |||||| | ||||||| |||| |||||||||||||||| ||||||||||| |
|
|
| T |
25531550 |
tcttcttcatggtcttggccatcttgtaaccaaccaaaaacactttcttttagagc |
25531495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University