View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17199_high_29 (Length: 320)
Name: NF17199_high_29
Description: NF17199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17199_high_29 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 1 - 313
Target Start/End: Original strand, 42929349 - 42929661
Alignment:
| Q |
1 |
ctgatcggtttttctttgagccagatgagaccaactccattttagaggttaataataaagctgctgcaattggaggtggtgaaactcaaagcttgccatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42929349 |
ctgatcggtttttctttgagccagatgagaccaactccatcttagaggttaataataaagctgctgcaattggaggtggtgaaactcaaagcttgccatt |
42929448 |
T |
|
| Q |
101 |
caaagatagtgtagttttatctatggaatctcgagatccttatgtcgattttcgaaagtctatggaggaaatagtagaagctcacgatgttaaagattgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42929449 |
caaagatagtgtagttttatctatggaatctcgagatccttatgtcgattttcgaaagtctatggaggaaatagtagaagctcacgatgttaaagattgg |
42929548 |
T |
|
| Q |
201 |
gaaggtcttcaagagcttttgagttggtatttgaaggtcaatgagaaaatcaatcatggctatattgttggtgcttttgttgatttattggttggtctta |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42929549 |
gaaggtcttcaagagcttttgagttggtatttgaaggtcaatgagaaaatcaatcatggctatattgttggtgcttttgttgatttattggttggtctta |
42929648 |
T |
|
| Q |
301 |
catattcttcgac |
313 |
Q |
| |
|
||| | ||||||| |
|
|
| T |
42929649 |
catttgcttcgac |
42929661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 47; Significance: 8e-18; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 192 - 286
Target Start/End: Complemental strand, 50463383 - 50463289
Alignment:
| Q |
192 |
aaagattgggaaggtcttcaagagcttttgagttggtatttgaaggtcaatgagaaaatcaatcatggctatattgttggtgcttttgttgattt |
286 |
Q |
| |
|
||||||||||| ||| | ||||||||||||||||||||||||| || |||| |||| |||||||| | |||||||||||||||||||||||| |
|
|
| T |
50463383 |
aaagattgggatggtttggaagagcttttgagttggtatttgaaagttaatggtaaaaataatcatgggtttattgttggtgcttttgttgattt |
50463289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 214 - 289
Target Start/End: Complemental strand, 25531099 - 25531024
Alignment:
| Q |
214 |
agcttttgagttggtatttgaaggtcaatgagaaaatcaatcatggctatattgttggtgcttttgttgatttatt |
289 |
Q |
| |
|
||||||||||||||||||| | || |||||||||| |||||||| | |||| ||| ||||||| |||||||||| |
|
|
| T |
25531099 |
agcttttgagttggtattttgaagttaatgagaaaagaaatcatggatttattattgatgctttttttgatttatt |
25531024 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University