View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17199_high_39 (Length: 266)
Name: NF17199_high_39
Description: NF17199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17199_high_39 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 129; Significance: 8e-67; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 129; E-Value: 8e-67
Query Start/End: Original strand, 1 - 129
Target Start/End: Original strand, 43823748 - 43823876
Alignment:
| Q |
1 |
cgaatcattttcttagatcgatttccccttccctattcaaatctcatttccagtcggtggattttgcctcgcctccaacaatggaagccactgacaactc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43823748 |
cgaatcattttcttagatcgatttccccttccctattcaaatctcatttccagtcggtggattttgcctcgcctccaacaatggaagccactgacaactc |
43823847 |
T |
 |
| Q |
101 |
atcagaatccaccgtctcaaatgtacaaa |
129 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
43823848 |
atcagaatccaccgtctcaaatgtacaaa |
43823876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 209 - 252
Target Start/End: Original strand, 43823956 - 43823999
Alignment:
| Q |
209 |
cgatgatattataatactttcgttaatcaggattctcaaagatt |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43823956 |
cgatgatattataatactttcgttaatcaggattctcaaagatt |
43823999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University