View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17199_high_45 (Length: 240)
Name: NF17199_high_45
Description: NF17199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17199_high_45 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 177; Significance: 2e-95; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 52 - 240
Target Start/End: Original strand, 27782321 - 27782509
Alignment:
| Q |
52 |
agggaagcaaggacctttccatggaatccattgattttctagacgaaaatgagtaagtaattgacatctaagaactgtggaattcttggttcgatttttt |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27782321 |
agggaagcaaggacctttccatggaatccattgattttctagacgaaaatgagtaagtaattgacatctaagaactgtggaattcttggttcgatttttt |
27782420 |
T |
|
| Q |
152 |
cttggtatatttgtgatgtaactcgttctttgcctttgaactgtggttcttgaaactctttttatgcttcgtagatacagactcctttt |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| || ||||||| |
|
|
| T |
27782421 |
cttggtatatttgtgatgtaactcgttctttgcctttgaactgtggttcttcaaactctttttatgcttcgtagatacggaatcctttt |
27782509 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 2 - 50
Target Start/End: Original strand, 27782239 - 27782287
Alignment:
| Q |
2 |
ttatactttacttgagaccggtttaagtttattctgtaactataaagtc |
50 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
27782239 |
ttatactttacttgagaccggtttaagtttattccgtaactataaagtc |
27782287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University