View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17199_low_9 (Length: 445)
Name: NF17199_low_9
Description: NF17199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17199_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 260; Significance: 1e-145; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 155 - 429
Target Start/End: Complemental strand, 46163278 - 46163003
Alignment:
| Q |
155 |
caactatcttctctgtttcccaaatttacagttttctcctcccgcaattcgtttatatctttcccataccccaa-ttcgttttcttttgctatggctttc |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
46163278 |
caactatcttctctgtttcccaaatttacagttttctcctcccgcaattcgtttatatctttcccataccccaaattagttttcttttgctatggctttc |
46163179 |
T |
 |
| Q |
254 |
gtttcgttttgaaagctttgttcattaggaggaggatccaacggtgatggatcaagaaggaggaggatccaacggtggcagtagatcttattgctattac |
353 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
46163178 |
gtttcgttttgaaagctttgttcattaggaggaggatccaacggtgatggatcaagaaggaggaggatccaacggtggcagtagatcttcttgctattac |
46163079 |
T |
 |
| Q |
354 |
tctgttcttggtattcgtagtgatgcctcctcctctgatattcgcaccgcttaccgcaaactcgctatggtaatac |
429 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46163078 |
tctgttcttggtattcgtagtgatgcctcctcctctgatattcgcaccgcttaccgcaaactcgctatggtaatac |
46163003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 81; E-Value: 6e-38
Query Start/End: Original strand, 13 - 101
Target Start/End: Complemental strand, 46163420 - 46163332
Alignment:
| Q |
13 |
aatatctaaactctcatcaccggcaaaattctctcgaactttcttccaatgtttctatttcccacaaaaccaaaaagtatgacaagata |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
46163420 |
aatatctaaactctcatcaccggcaaaattctctcgaactttcttcccatgtttctatctcccacaaaaccaaaaagtatgacaagata |
46163332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University