View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1719_high_5 (Length: 262)
Name: NF1719_high_5
Description: NF1719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1719_high_5 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 156; Significance: 6e-83; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 1 - 246
Target Start/End: Complemental strand, 34432218 - 34431988
Alignment:
| Q |
1 |
aaaataaataaagagaagatagttcactacggtgtcgtttttcttataaaaagaggggnnnnnnntatcttccaccattttcccgctaaaaagcagagaa |
100 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||| |||||||||| |||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
34432218 |
aaaataaataaatagaagatagttcactacggtgtcgttttgcttataaaaa-aggg--aaaaaatatcttccaccattttcccgctaaaaagcagagaa |
34432122 |
T |
 |
| Q |
101 |
tcacgtttctagaatcttccatcaccgccgtcgtcgccgccgtaatggtaacctgcttcttctcttccgatcatttctcaatgcgcgtttcgattttcaa |
200 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
34432121 |
tcacgtttctagaatcttcc------------gtcgccgccgtaatggtaacctgcttcttctcttccgatcatttctcaatgcgcatttcgattttcaa |
34432034 |
T |
 |
| Q |
201 |
ctctatcgtttgaatcactaacttcaatttcttcacactttagttt |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34432033 |
ctctatcgtttgaatcactaacttcaatttcttcacactttagttt |
34431988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University