View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1719_low_12 (Length: 212)
Name: NF1719_low_12
Description: NF1719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1719_low_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 35667523 - 35667720
Alignment:
| Q |
1 |
tgcttatgctctccttataaatagaggatacaattgtacgagcttatagaaccgatcatgttcaagcaaagagtcgtgcatttttctctctcttaaaaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35667523 |
tgcttatgctctccttataaatagaggatacaattgtacgagcttatagaaccgatcatgttcaagcaaagagtcgtgcatttttctctctcttaaaaat |
35667622 |
T |
 |
| Q |
101 |
caaactaaaacacacaatttttcttacagatcaggatcgttgctcactattttgatattcaaatgtaaaatgtttttggtctaaattttgtatcaaat |
198 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
35667623 |
caaactaaaacccacaatttttcttacagatcaggatcgttactcactattttgatattcaaatgtaaaatatttttgttctaaattttgtatcaaat |
35667720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University